• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The invention relates to a method for detecting Erwinia amylovora in a sample by amplifying one or more Erwinia amylovora sequences in the sample using the LAMP method by means of specific for this sequence (s) specific primers and optionally compared with known sequences, with in that the reference sequence used is the genomic sequence of the bases 1378996 to 1379215 of the Erwinia amylovora genome which codes for the hypothetical protein AMY1267 of strain Ea273 as set forth in SEQ ID NO: 1 and which is described in Seq. ID Nos. 2 to 7 existing set of specific LAMP primers for amplification is used.
    公开号:AT510418A4
    申请号:T6402011
    申请日:2011-05-06
    公开日:2012-04-15
    发明作者:Karl Dr Stich；Thilo Dr Fischer；Christian Dr Gosch
    申请人:Univ Wien Tech；
    IPC主号:
    专利说明:

    «« · «* * * · · · · ·« ** ··· ** * * * ψ * * * * * * * t · · * | »··· * · ·» · * * * · * ·· I 41
    The present invention relates to a method for detecting the fire blast pathogen Erwinia amylovora.
    Fire blight is caused by the gram-negative bacterium Erwinia amylovora, which affects plants of the family Rosacea, especially genera of the subfamily Maloideae (pome fruit trees), especially apple (Malus x domestica), pear (Pyrus communis) and quince (Cydonia oblonga). The infection usually occurs via the flower (primary fire blight). In contrast, infections over the foliage, later in the growing season, are referred to as secondary fire blight. The infection of the flower spreads over the xylem and leads to a progressive necrosis in the wood. The disease causes devastating damage to orchards with corresponding economic losses.
    Regionally, at the time of flowering, prognoses of the fire-blight infection risk may e.g. be carried out according to the model MARYBLYT. Current and local temperature and humidity values in the form of critical threshold values and time sums during flowering are assessed in this model (Steiner 1990, Lightner and Steiner 1990, Jones 1992). The probable infection status derived from the previous year's fire blight situation is often taken into consideration, but may be inaccurate due to the high bacterial dynamics. The most informative would therefore be specific test results on the current and local infection status during flowering. However, tests with flowers or flower tufts are confronted with low levels of cell titels during the early infection phase and should be sensitive accordingly. In addition, the short flowering time is a very tight time frame for tests, which usually does not allow to send samples to laboratories to receive the results of tests during flowering and, if necessary, to be able to take timely countermeasures.
    A quick and sensitive test on Erwinia amylovora, which is also possible under field conditions or at least in simply equipped laboratories on site, would be very desirable for these reasons. In addition to the MARY-BLYT prognosis of infection conditions, such a test would provide very important information about the -1 - • Λ
    * * · · * »··» φ · I • ·· *** ·· »· * ··
    ... This would allow a timely local decision on the need for countermeasures against the spread of the pathogen during flowering. Of course, with high infection status, cost-effectiveness would be to avoid fire blight damage, but the proven local absence of the pathogen would have the economic advantage of not having to take unnecessary measures, including the environmental benefit of reduced, adapted pesticide use.
    Tests for microbial pathogens are typically performed by selective culture or culture with indicators, or, less laboriously, by immunological assays such as ELISA, or by PCR reactions to specific nucleic acid sequences. Both ELISA and PCR assays for microbial pathogens are much faster than identification by culture, unless they need to be combined with precultures to reach the detection limit or to ensure sufficient specificity. Tests under field conditions require further methodological simplifications and usually preclude the use of thermocyclers, which are required for PCR reactions. Therefore, ELISA tests are often used under field conditions, although they are usually much less sensitive and non-specific than PCR tests.
    Some recent nucleic acid amplification methods operate at a constant temperature, usually in the range of 60-65 X, thereby obviating the need for thermocyclers but still achieving the sensitivity of PCR reactions. The most important of these isothermal amplification techniques are NASNA ("nucleic acid sequence-based amplification", Compton 1991), SDA ("Strand displacement ampiification", Walker et al., 1992), FIRCA (synonym: CRCA) ("hyperbranched (or: Cascade) rolling circle amplification ", Lizardi et al., 1998, Thomas et al., 1999), HDA (" helicase dependent amplification ", Vincent et al., 2004, et al., 2005), LAMP ('Ίοορ- Mediated isothermal amplification of DNA ", Notomi et al., 2000, Nagamine et al., 2002) and RPA (recombinase polymerase amplification, Piepenburg et al., 2006). In general, these techniques circumvent the melting of double-stranded DNA (or DNA-RNA hybrids in the case of NASBA) to produce nucleic acid nucleic acid strands Hybridization of the primers (starting points of the synthesis) and as template for the template synthesis ("template").
    Starting points of the synthesis are created by single-strand breaks ("nicks") by restriction enzyme (SDA), by circular single-stranded DNA (CRCA), strand separation in a promoter region (NASBA), regenerating hairpin loops (LAMP) or D formed by recombinase activity Loops (RPA). The need to provide a single-stranded template for synthesis is avoided in isothermal methods by utilizing strand displacement activity of a DNA polymerase (NASBA, SDA, CRCA, LAMP, RPA) or RNA polymerase (NASBA); or a single strand is generated by a separate helicase activity (HDA); or the opposite strand is degraded by an enzyme (RNAse H, NASBA).
    Of these DNA diagnostic methods, LAMP is widely used since LAMP amplifies DNA with high efficiency and specificity (e.g., Gill and Ghaemi 2008, and the citations therein). LAMP also makes it possible to circumvent gel electrophoresis for the analysis of the products, since in positive reactions, a white magnesium pyrophosphate precipitate forms, which is visible to the naked eye. This allows homogeneous analysis without further handling and without reopening of the reaction vessels, which entails the risk of contaminating workplaces, equipment and ultimately subsequent reaction mixtures with the very high concentration of amplification products. The LAMP reaction becomes even more practical with the addition of the metal ion indicator hydroxynaphthol blue (HNB) as a colorimetric test, which shows a positive change in color from purple to blue (Goto et al., 2009, Hadersdorfer et al., 2011).
    A LAMP method for plasmid-specific Erwinia amylovora sequences has recently been published (Temple and Johnson 2011). The authors tested a total of 45 primer sets for the amplification of Erwinia amylovora DNA, specifically describing the detection of plasmid DNA, while mentioning that tests with chromosomal DNA had also been performed. However, the authors did not succeed in reliably detecting the bacterium, since many of them
    Artifacts occurred, both false-positive and false-negative reactions. Among other things, it was confused with the epiphyte Pantoea agglomerans, a common in orchards Enterobacterium.
    The aim of the invention was therefore the development of an improved LAMP method for DNA amplification of Erwinia amylovora sequences so as to detect the pathogen with increased reliability.
    DISCLOSURE OF THE INVENTION
    This object is achieved by providing a method for detecting Erwinia amylovora sequences in a sample by amplifying one or more Erwinia amylovora sequences using the LAMP method and optionally comparing them with known sequences, the method of the invention being characterized in that, on the one hand, the reference sequence used is the genomic sequence of the bases 1378996 to 1379215 of the Erwinia amylovora genome which codes for the hypothetical protein AMY1267 of the strain Ea273, as set forth in SEQ ID NO: 1, and, on the other hand, the Seq. ID Nos. 2 to 7 set of specific LAMP primers for amplification is used.
    The above genomic sequence with SEQ ID NO: 1 was obtained from the cDNA library decrypted by the Sänger Institute and made available to the public on its website (http://www.sanger.ac.uk/resources/downloads/bacteria/erwinia-amylovora. html) data of the Erwinia amylovora genome.
    Without wishing to be bound by theory, it is believed that the numerous artifacts of detection according to the above-mentioned method of Temple and Johnson were also due to the fact that (at least predominantly) a plas-mid DNA was selected as a target. The advantage of the (potential) presence of plasmid DNA in multiple copies, that is to say in potentially higher concentration in the sample, is in the view of the inventors nullified by the fact that: a) a particular plasmid sometimes does not occur in all strains of the species to be detected (also Temple and Johnson have confirmed), b) plasmids, eg due to external influences. * * * * * * V * «« ·· # * »· ♦ · · * ·» * * · · * «#« · «· · · · · ·« «· · · · t * * · • · ♦ · · · · · · · · ♦ ♦ ♦ ♦ · ♦ · 4 »s, comparatively easily deactivated, and c) plasmids can be transferred to other species or even genera.
    By using the genomic DNA sequence of Erwinia amylovora as reference sequence described in SEQ ID NO: 1, the present invention ensures that all known strains of the species Erwinia amylovora are detected and artifacts due to plasmid deactivation or transfer are effectively avoided. False-negative results are thus practically excluded.
    The LAMP primers of Seq. ID Nos. 2 to 7 used as primers for the amplification reaction allow a rapid and reliable amplification of the Erwinia amylovora DNA contained in the sample. Most importantly, with this highly specific set of primers for SEQ ID NO: 1, the amplification of potential contaminating DNA is virtually ruled out, so essentially no false-positive results, i. Artifacts can be obtained.
    The primers were selected using the online software " Primer Explorer V4 " (http://primerexplorer.jp/e/, Eiken Chemical Co., Tokyo, Japan) and by screening databases using NCBI blast for sequences of potential contaminants. Primers that had too much sequence similarity to available sequences of these DNA contamination sequences were appropriately altered or excluded until finally a complete set of primers could be determined which in practice should give essentially no cross-reactions. In the selection of these primers, in particular, possible contamination by DNA of apple, pear, bee, epiphytic microorganisms, e.g. Erwinia persicina, Erwinia pyrifoliae, Erwinia tasmaniensis, Erwinia piriflorinigrans, Erwinia billingiae, Paneaea agglomerans, Bacillus licheniformis, Bacillus coagulans, Bacillus cereus, Bacillus subtilis subsp. Subtilis and Staphylococcus aureus, but also by human DNA, which may have been introduced during the handling of the sample considered. As the later examples prove, no artifacts were observed with this primer set. -5- • V * * * Φ * «f ·« «« · »* · · f t · * ··· • · < * * * · # «* * 4 · · * ·« * For this primer set, a parameter relevant to relevant parameters, such as Temperature, Bst DNA polymerase, Mg2 +, HNB, betaine and deoxynucleoside tri-phosphate concentration, absolute and relative primer concentration and reaction time, optimized protocol, as set forth in the Examples.
    The thus developed method of the present invention allows colorimetric detection to a detection limit of about 80 to 100 fg DNA, which corresponds to only 20 to 25 cells of Erwinia amylovora, in 45 minutes, even under field conditions. The detection limit for the use of bacterial cells as a template in the LAMP reaction is approximately 16 to 20 cells in 45 minutes. By using the genomic target sequence with SEQ ID NO: 1 also plasmid-free, but sometimes pathogenic Erwinia amylovora strains can be detected. Dilution series from the Erwinia amy / ovora cell suspensions obtained from the samples to below the detection limit can be used to determine the semiquantitative results. In certain embodiments of the method of the invention, the products of LAMP amplification are analyzed by gel electrophoresis and / or with fluorescent dyes in real time thermocyclers or fluorimeters, respectively, providing particularly rapid and unambiguous results.
    The LAMP reaction is preferably carried out at 60-65 ° C, which is sufficient to allow LAMP amplification to proceed rapidly but at the same time requires no expensive equipment. This enables the provision of a portable device, i. an analyzer that is operable on-site, such as in an orchard.
    With regard to performing such analyzes in the field, successful amplification of the reference sequence with SEQ ID NO: 1 is preferably detectable by simple visual inspection with the naked eye, which allows a rapid determination of the analytical result and beyond the design of an above-mentioned 6 * * »* * M iM» * i • · · · * * I · ι • »« · «« · «« «
    f * ··> *! · i · 4M * · * · · * * I *
    I ······· 4 I further simplified analyzer. For this purpose, according to the present invention, hydroxynaphthol blue is preferably added as an indicator of the LAMP reaction, thereby indicating successful amplification of the reference sequence of SEQ ID NO: 1 by means of an easily recognizable color change.
    However, in further particularly preferred embodiments, the extent of the color change is also evaluated semiquantitatively in order to be able to estimate the bacterial titer and thus the extent of the infestation (for example of fruit trees) with the pathogen with sufficient accuracy for a first report.
    BRIEF DESCRIPTION OF THE DRAWINGS
    The invention will be further described in the following examples with reference to the accompanying drawings. These show the following.
    FIGS. 1 and 2 respectively show results of tests for cross-reactions of the primer set according to the invention by verification of the specificity by means of gel electrophoresis (2%, above) and by means of color change (below).
    FIGS. 3 and 4 each show the results of gel electrophoresis in optimization experiments with the primers according to the invention.
    FIGS. 5 and 6 show results of the investigation of the detection limits of the method according to the invention by means of gel electrophoresis (2%, above) and color change (below).
    EXAMPLES
    Example 1: Selection of the reference and the primers
    As reference sequence for the detection of the pathogen and target sequence for the development of primers for the specific amplification of genomic E. amy / ovora DNA, as mentioned, that sequence section of the hypothetical protein AMY1267 of the strain Ea273 (http://www.sanger.ac .uk / resources / downloads / bacteria / erwinia-amylovora.html) set forth in SEQ ID NO: 1. Sequence information -7- * * * «« * * 4 * M * * • * I f »* * * * *» ******* »« · · ·· * «···» II * • AMY1267 was recently developed for the development of a Taqman real-time PCR test on £. used amylovora (Gottsberger, 2010). Comparisons of the selected target sequence with SEQ ID NO: 1 in the NCBI database in the nucleotide blast query mode (www.ncbi.nlm.nih.gov) were not similar to publicly available sequences except for £. amylovora, see Table 1 below.
    Table 1
    Acc. Description Collection Maximum Identity FN434113.1 Erwinia amylovora CFBP1430 comptete genome 100% 100% FN666575.1 Erwinia amylovora ATCC 49946 chromosomal sequence 100% 100% FR719190.1 Erwinia amylovora ATCC BAA-2158, whole genome shotgun sequence. contig 10 99% 100%
    The location of the primer set sequences and their comparison theoretically preclude the formation of artifacts by primer mismatch. The primer set listed in Sequence Listing, SEQ ID NOs: 2-7, listed in Table 2 below, was analyzed using the online software "PrimerExplorer V4". (http://primerexplorer.jp/e/ (Eiken Chemical Co., Tokyo, Japan)) The names of the primers (first column) were chosen analogously to Notomi et al. (2000) and Nagamine et al. (2002) ,
    Table 2
    Ref. Primer type Sequence (5 -3 'orientation) 15-F3 forward outer CTTTTTT AAG AG AG GC AGC A 15-B3 backward outer TTGTCTGAATCCAGATGTCT 15-FIP forward inner GG AG ACCGAT CTTTT ACAGACTTTTT CGACGAACGTTT ATACGA 15-BIP backward inner GAGCTTCGAACATAGT C AAGGGGAAG ATTTAT GCCTT CCAG AAG 15-LF loop forward C AG AACTTACC ATAT AAT CA 15-LB loop backward ACGGCGCAAAAAT
    Example 2: Specificity of the method
    The primers of SEQ ID NOS: 2-7 of the invention were given at 64 pounds. amylovora strains (Gottsberger, 2010), see Table 3 below, and with 17 samples of foreign DNA, see Table 4 below, tested for their specificity. -8- * * «« «· ♦ *» ······ Amplification was only observed with the E. amylovora samples and no cross-reactions were detected with foreign DNA. Even closely related Erw / ma species did not cross-react (see the results for E. persicina, E.pyrifoliae, E. tasmaniensis and E.piriflorinigrans).
    Table 3
    Species Origin, strain / strain Amplification Erwinia amylovora AGES 295/93 + Erwinia amylovora AGES 674/94 + Erwinia amylovora AGES 273/96 + Erwinia amylovora AGES 329/98 + Erwinia amylovora AGES 511/98 + Erwinia amylovora AGES 963/99 + Erwinia amylovora AGES 1851/01 + Erwinia amylovora AGES 2642/01 + Erwinia amylovora AGES 855/02 + Erwinia amylovora AGES 3218/02 4- Erwinia amylovora AGES 3331/02 + Erwinia amylovora AGES 3910/02 + Erwinia amylovora AGES 3962/02 Erwinia amylovora AGES 1170/02 + Erwinia amylovora AGES 1141/03 + Erwinia amylovora AGES 1141/03 + Erwinia amylovora AGES 1141/03 + Erwinia amylovora AGES 1144/03 + Erwinia amylovora AGES 1168/03 + Erwinia amylovora AGES 1170/03 + Erwinia amylovora AGES 1195/03 + Erwinia amylovora AGES 1672/03 + Erwinia amylovora AGES 374/03 + Erwinia amylovora AGES 376/03 + Erninia amylovora AGES 377/03 + Erwinia amylovora AGES 378/03 Erwinia amylovora AGES 2663/03 + Erwinia amylovora AGES 408/05 + Erwinia amylovora AGES 769 / 05 + Erwinia amylovora AGES 703/06 + Erwinia amylovora AGES 384/07 + Erwinia amylovora AGES 2803/07 + Erwinia amylovora AGES 3204/07 + Erwinia amylovora AGES 3392/08 + Erwinia amylovora AGES 498/09 + Erwinia amylovora AGES 568/09 + Erwinia amylovora AGES 602/09 + Erwinia amylovora AGES 603/09 + Erwinia amylovora AGES 74/10 + Erwinia amylovora AGES 313/10 + Erwinia amylovora AGES 397/10 + Erwinia amylovora AGES 398/10 + Erwinia amylovora AGES 596/10 + Erwinia amylovora AGES 628 / 10 + Erwinia amylovora AGES 1-284 / 10 + Erwinia amylovora CFBP 1232 + Erwinia amylovora CFBP1399 + Erwinia amylovora CFBP 1430 + -9- I t · 4 · * ·· »* * · k ι ι < «« I »* * *» · »· * *» »it | * * »*» ·· * · • * «· · # * *» ·
    Erwinia amylovora CFBP2151 Erwinia amylovora CFBP 2584 Erwinia amylovora CFBP 3042 Erwinia amylovora CFBP 3794 Erwinia amylovora DSM 17948 + Erwinia amylovora GCCM 909 + Erwinia amylovora Ea12 + Erwinia amylovora 115-22 + Erwinia amylovora 7/74 + Erwinia amylovora IVIA 1509-B + Erwinia amylovora IVIA 1892-1 + Erwinia amylovora NCPPB 2292 + Erwinia amylovora NCPPB595 Erwinia amylovora OMPBO 1204.1 / 94 Erwinia amylovora AGES 681/06 + Erwinia amylovora pEA29 deficient IVIA 1596 + Erwinia amylovora pEA29 deficient IVIA 1614-2 +
    Table 4
    Species Origin, Strain Amplification Erwinia persicina AGES 556/10 - En / vinia pyrifoliae CFBP 4171 - Panioea agglomerans AGES R95-91 - Pantoea agglomerans AGES 599 - Pantoea agglomerans AGES 701 - Erwinia tasmaniensis AGES 37/10 - Erwinia piriflorinigrans CFBP 5868 - Erwinia billingiae CFBP 6830 - Malus x domestica 'Rewena' DNA {Jedlersdorf 2008) - Pyrus communis' Abbe Fetel · DNA (Jedlersdorf 2008) - Homo sapiens DNA (Oral Swab 2010) - Apis mellifera DNA (Bees, AGES, 2010) - Bacillus licheniformis NCTC 10341 - Bacillus coagulans NCTC 10334 - Bacillus cereus NCTC 2599 - Bacillus subtilis subsp. subtilis NCTC 10315 - Staphylococcus aureus ATCC 65389 -
    Where to buy: OMP BO Osservatorio delle Malattie delle Piante, Bologna, Italy CFBP Collection Frangaise de Bacteries Phytopathogenes, INRA, Angers, France. AGES Austrian Agency for Health and Food Safety, Institute of Plant Health, Vienna, Austria. DSMZ German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany. IVIA Instituto Valenciano de Investigaciones Agrarias, Moncada (Valencia), Spain. NCPPB National Collection of Plant Pathogenic Bacteria, Plant Pathology Laboratory, Harpenden, Hertsfordshire, U.K. GCCM Greek Coordinated Collections of Microorganisms, Benaki Phytopathological Institute, Athens, Greece. NCTC National Collection of Type Cultures, Central Public Health Laboratory, London, U.K. ATCC American Type Culture Collection, Manassas, Maryland, USA. I > l I ·························································································································································································································· ··· · • * «« * iI · * »
    The results of tests for cross-reactions of the primer set according to the invention by verification of the specificity by means of gel electrophoresis (2%, above) and color change (bottom) are respectively shown in FIGS. 1 and 2. On the far left, as positive controls, the results are shown the response of E. amylovora DNA, and on the far right (" M ") those of the DNA marker, lambda Eco471. In between, there are results of the first 8 (Figure 1) and the latter 9 (Figure 2) foreign DNA samples from Table 4. It can be clearly seen that foreign DNA consistently gave unambiguously negative results.
    Example 3: Optimization for Amplification Efficiency
    The concentrations of the individual components (betaine, MgS04, primer FIP, BIP, F3, B3, LF, LB, deoxynucieoside triphosphates, flydroxynaphthol blue, βsf DNA polymerase) and the reaction temperature of the method of the invention were optimized for amplification efficiency. In general, the amplification over a wide concentration and temperature range was satisfactory. The maximum amplification was achieved with the following conditions in 25 μl reaction volume: 1 × reaction buffer (New England Biolabs, Frankfurt, Germany, 20 mM Tris-HCl, 10 mM (NH 4) 2 SO 4, 10 mM KCl, 2 mM MgSO 4, 0.1%. Triton X-100, pH 8.8), 8 IU Bst DNA polymerase, 8mM supplemental MgS04 (10mM final concentration), 0.7M betaine, 0.18μΜ 15-F3 and 15-B3 primer, 1, 62 μΜ 15-FIP and 15-BIP primer, 4.2 μΜ 15-LF and 15-LB loop primer, 1.6 mM deoxynucieoside triphosphates, 180 μΜ hydroxynaphthol blue. Incubation at 63 ° C for 30 min (amplification) and at 80 ° C for 3 min (enzyme inactivation) in an Eppendorf EP gradient thermocycler.
    FIG. 3 shows by way of example an example of an optimization step. Nos. 1 and 2 indicate the non-optimized (1) or optimized (2) reaction of the gel electrophoresis (2%) subjected to LAMP products. &Quot; M " again denotes the DNA marker Lambda Eco47l.
    Fig. 4 shows the results of gel electrophoresis (2%) of primer ratio optimization products. Several ratios of primers 15-F3, 15-B3: 15-FIP, 15-BIP in integer steps of 1: 7 to 1 are shown : 11th Like -11 - * · · »4 · * 4 · Μ tl» · »Φ» «« «« Φ »« «« «« · · · · «« «··« »4 ··« • 4 · 4 «4 4 4 · * * 44 * ·· 4« + clearly, the optimum was at a ratio of 1: 9. Again, " M " the DNA marker Lambda Eco47l.
    Example 4 - Adaptation of the method with regard to the color change For the above reasons, the aim is to achieve the highest possible color change in the reaction for the above reasons. Since the initial concentrations of Mg2 + ions and deoxynucleoside triphosphates influence the staining with hydroxynaphthol blue (HNB), the optimized method was adapted to the practical application. For this, the final concentration of MgS04 was reduced from 10 mM to 9 mM and that of the deoxynucleoside triphosphates from 1.6 mM to 1.2 mM. Through these adjustments, an optimally recognizable color change could be achieved while maintaining a very good amplification rate.
    Example 5 - Sensitivity of the process
    To verify the detection limits were £. Amy / oi / ora DNA dilution series or dilutions of bacterial cells were prepared and used in the method of the invention. At a incubation time of 45 min in a 25 μΙ reaction mixture still 80 to 100 fg DNA could be reliably detected, as shown in Fig. 5. This corresponds mathematically with a genome size of E. amylovora of 3.9053 x 10'9 pg about 20 to 25 bacterial cells. Under the same reaction conditions, approximately 16 to 20 bacterial cells could be reliably detected in the batch, as shown in FIG. 6. Occasionally, but not reliably reproducible, even 1 single bacterial cell or 1 μg of DNA per reaction mixture could be detected. The infection of apple blossoms in the field requires about 105-106 bacteria / flowering (Taylor et al., 2003). Thus, according to the method of the invention, bacterial titers can be detected well below the infection threshold in practice use by color change.
    Figures 5 and 6 show the results of verification of amplification by gel electrophoresis (2%, above) and color change (below). In FIG. 5, from left to right, the results for 100, 80, 60, 40, 20 and 0 fg are shown on isolated E. amy- »« * «· · · ft · * · ♦ · · · ·« · * # I · «· · · · · · · · ·» > Fig. 6 shows those for 20, 18, 16, 14, 12, 10, and 0 cfu of E. amylovora. &Quot; M " again denotes the DNA marker Lambda Eco47l.
    The invention thus provides a method for detecting Erwinia amylovora in a sample using LAMP amplification, by means of which the pathogen can now be reliably detected for the first time. -13-
    ···························································································································································································································· * 9999 9 * * * 9 9 9 »* * 9
    literature
    An, L., Tang, W., Ranalli, TA, Kim, HJ, Wytiaz, J., Kong, H., Characterization of a thermostable helicase and its participation in helicase-dependent amplification, J. Biol. Chem. 280, 28952-28958 (2005).
    Compton, J., Nucleic acid sequence-based amplification, Nature 350, 91-92 (1991).
    Gill, P., Ghaemi, A., Nucleic acid isothermal amplification technologies, Nucleosides, Nucleotides, and Nucleic Acids 27, 224-243 (2008).
    Gottsberger, R.A., Development and evaluation of a real-time PCR assay targeting chromosomal DNA of Erwinia amylovora, Leiter in Applied Microbiology 51, 285-292 (2010).
    Goto, M., Honda, E., Ogura, A., Nomoto, A., Hanaki, Κ.-L, Coiorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol biue, Biotechniques 46, 167-172 (2009 ).
    Hadersdorfer, J., Neumüller, M., Treutter, D., Fischer, T.C., Fast and reliable detection of Plum pox virus in woody Sharka host plants using the Biology LAMP protocol, 2010 filed with Annals of Applied Biology (2011).
    Jones, A.L., Evaluation of the computer model MARYBLYT for predicting fire bf. 76, 344-347 (1992).
    Lightner, G.W., Steiner, P.W., Computerization of blossom blight prediction model, Acta Hort. (ISHS) 273, 159-162 (1990).
    Lizardi, PM, Huang, X., Zhu, Z., Bray-Ward, P., David, Cr Thomas, DC, Ward, DC, Mutation detection and singie-motecule counting using isothermal rolling-circle amplification, Nature Genetics 19, 225-232 (1998).
    Nagamine, K., Hase, T., Notomi, T. Accelerated reaction by loop-mediated isothermal amplification using loop primers, Molecular and Cellular Probes 16, 223-229 (2002).
    Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., Loop-mediated isothermal amplification of DNA, Nucleic Acids Res. 28, E63 (2000).
    Piepenburg, O., Williams, C.H., Stemple, D.L., Armes, N.A., DNA detection using recombination proteins, PLoS Biol. 4 (7), E204 (2006). DOI: 10.1371 /journal.pbio.0040204
    Steiner, P.W., Predicting apple blossom infections by Erwinia amylovora using the MARYBLYT model, Acta Hort. (ISHS) 273, 139-148 (1990). -14- * t «* * · ♦« ··· «· •« · * · ♦ · ** ψ * · · ♦ * ··· * * * • · «··« · * · «» »4 «• · · · ·» 9 * * · »« 4 * «· · · ·
    Taylor, RK, Haie, CN, Henshall, WR, Armstrong, JL, Marshall, JW, Effect of inoculum can on infection of apple (Malus domestica) flowers by Erwinia amylovora, New Zealand Journal of Crop and Horticultural Science 31, 325-333 ( 2003).
    Temple, T.N., Johnson, K., Evaluation of Loop-Mediated Isothermal Amplification for Rapid Detection of Erwinia amylovora on Pear and Apple Fruit Flowers, Plant Dis. 95 (4), 423-430 (2011).
    Thomas, D., Nardone, G., Randall, S., Amplification of Padlock Probes for DNA Dia-gnostics by Cascade Rolling Circle Amplification or the Polymerase Chain Reaction, Archives of Pathology and Laboratory Medicine 123, 1170-1176 (1999).
    Vincent, M., Xu, Y., Kong, H., Helicase-dependent isothermal DNA amplification, EMBO Reports 5, 795-800 (2004).
    Walker, GT, Fraiser, MS, Schram, JL, Little, MC, Nadeau, JG, Malinowski, DP, Strand displacement amplification - an isothermal, in vitro DNA amplification technique, Nucleic Acids Res. 20, 1691-1696 (1992 ). It does not matter
    • »· · * * * * *« «» ·· »> * ··» • ··· ♦ > ··· 4 * «« I «« · · «··« ♦ »4 * · 4 4 · · · ·
    SEQUENCE LOG <110 = &quot; Vienna University of Technology &lt; 120 &gt; Method for detecting Erwinia amytovora by means of LAMP &lt; 130 &gt; 111794 &lt; 160 &gt; 7 &lt; 170 &gt; NCBI Blast &lt; 210 &gt; 1 &lt; 211 &gt; 220 &lt; 212 &gt; DNA &lt; 213 &gt; Erwinia amyiovora &lt; 220 &gt; &Lt; 221 = &gt; CDS &lt; 222 &gt; (1) ... (220) &lt; 223 &gt; Coding sequence for the hypothetical protein AMY1267 from strain Ea273 &lt; 400 &gt; 1 ttgtctgaat ccagatgtct cttttttaga agatttatgc cttccagaag gtcattttta 60 tcagcatgaa taactatttt ttgcgccgtc ccttgacta tgttcgaagc tctcattgcc 120 gtggagaccg atcttttaca gacfttaata tcagaactta ccatataatc ataaatgagt 180 tcgtataaac gttcgtcgaa tgctgcctct cttaaaaaag 220 &lt; 210 &gt; 2 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial sequence &lt; 220 &gt; &Lt; 223 &gt; LAMP primer &lt; 400 &gt; 2 CTTTTTAAG AGAGGCAGCA 20 <210> 3 &lt; 211 &gt; 20 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial sequence &lt; 220 &gt; &Lt; 223 &gt; LAMP primer &lt; 400 &gt; 3 TTGTCTGAAT CCAGATGTCT 20 &lt; 210 4 &lt; 211 &gt; 45 &lt; 212 &gt; DNA &lt; 213 &gt; Artificial sequence -1 • · «« · # # tt «l •» · * »· * &lt; • * * «» ··················································································································································································································································· ; LAMP primer &lt; 400 &gt; 4 40 45
    GGAGACCGAT CTTTTACAGA CTTTATTCGA CGAACGTTTA
    TACGA &lt; 210 &gt; 5 &lt; 211 &gt; 44
    &Lt; 212 &gt; DNA &lt; 213 &gt; Artificial sequence &lt; 220 &gt; &Lt; 223 &gt; LAMP Primer &lt; 400 5 40 44
    GAGCTTCGAA CATAGTCAAG GGGAAGATTT ATGCCTTCCA
    GAAG &lt; 210 &gt; 6 &lt; 211 &gt; 20
    &Lt; 212 &gt; DNA &lt; 213 &gt; Artificial sequence &lt; 220 &gt; &Lt; 223 &gt; LAMP primer &lt; 400 &gt; 6 20
    CAGAACTTAC CATATAATCA &lt; 210 7 &lt; 211 &gt; 14
    &Lt; 212 &gt; DNA &lt; 213 &gt; Artificial sequence &lt; 220 &gt; &Lt; 223 &gt; LAMP primer &lt; 400 &gt; 7 14 ACGGCGCAAA ΑΑΑΤ -1 -
    权利要求:
    Claims (6)
    [1]
    »« Μ · • ♦ * Λ φ Φ Φ Φ I f • «· · * * * · · · · · · · · · · · · · · Φ - Λ« · · • * 9 * * -; 1. A method of detecting Erwinia amylovora in a sample by assaying for one or more Erwinia amyvora sequences in the sample using the LAMP method using this sequence (s ) specific primers and optionally compared with known sequences, characterized in that as reference sequence the genomic sequence of the bases 1378996 to 1379215 of the Erwinia amytovora genome which codes for the hypothetical protein AMY1267 of the strain Ea273, as described in Seq.-ID no 1, and the set of specific LAMP primers consisting of SEQ ID NOs: 2 to 7 is used for amplification.
    [2]
    2. The method according to claim 1, characterized in that the products of the LAMP amplification are analyzed by gel electrophoresis and / or with fluorescent dyes in real-time thermocyclers or Fluorimetern.
    [3]
    3. The method according to claim 1 or 2, characterized in that the LAMP reaction is carried out at 60-65 ° C.
    [4]
    4. The method according to any one of claims 1 to 3, characterized in that a successful amplification of the reference sequence with Seq.-ID No. 1 is determined by visual inspection with the naked eye.
    [5]
    5. The method according to claim 4, characterized in that hydroxynaphthol blue is added as an indicator for the LAMP reaction and a successful amplification of the reference sequence with Seq.ID Nr, 1 is indicated by a color change.
    [6]
    6. The method according to claim 5, characterized in that the extent of the color change semiquantitativ is evaluated.

    -1 -
    类似技术:
    公开号 | 公开日 | 专利标题
    Schena et al.2006|Detection and quantification of Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real‐time PCR
    Farber1996|An introduction to the hows and whys of molecular typing
    Hamiduzzaman et al.2010|A multiplex PCR assay to diagnose and quantify Nosema infections in honey bees |
    Mercado-Blanco et al.2003|Quantitative monitoring of colonization of olive genotypes by Verticillium dahliae pathotypes with real-time polymerase chain reaction
    Mirmajlessi et al.2015|PCR-based specific techniques used for detecting the most important pathogens on strawberry: a systematic review
    Tooley et al.2006|Real-time fluorescent polymerase chain reaction detection of Phytophthora ramorum and Phytophthora pseudosyringae using mitochondrial gene regions
    WO2001007648A1|2001-02-01|Method for the species-specific detection of organisms
    EP1254254B1|2011-11-09|Nucleic acid molecules for detecting bacteria and phylogenetic units of bacteria
    Żaczek et al.2019|Differentiation of Clavibacter michiganensis subsp. sepedonicus using PCR melting profile and variable number of tandem repeat methods
    Buller et al.2010|Understanding the molecular epidemiology of the footrot pathogen Dichelobacter nodosus to support control and eradication programs
    AT510418B1|2012-04-15|LAMP PROCEDURE FOR IDENTIFYING ERWINIA AMYLOVORA
    Leal et al.2013|Development of two reverse transcription‐PCR methods to detect living pinewood nematode, B ursaphelenchus xylophilus, in wood
    de Carvalho et al.2019|Technical and economic efficiency of methods for extracting genomic DNA from Meloidogyne javanica
    Hannou et al.2013|Characterization of Erwinia amylovora strains from Middle Atlas Mountains in Morocco by PCR based on tandem repeat sequences
    Waiblinger et al.2014|Guidelines for validation of DNA extraction methods applied in subsequent PCR analysis of food and feed products for the presence of genetically modified material
    Bai et al.2013|Extraction of DNA from orange juice, and detection of bacterium Candidatus Liberibacter asiaticus by real-time PCR
    Dreo et al.2012|Real-time PCR, a method fit for detection and quantification of Erwinia amylovora
    DE102014116204B3|2015-08-27|Method for the quantitative detection of a contamination of a liquid by a microorganism by means of quantitative polymerase chain reaction
    DE102015012691A1|2017-03-30|Method for the quantitative detection of Vibrio parahaemolyticus, Vibrio vulnificus and Vibrio cholerae
    Carney et al.2016|Molecular diagnostic solutions in algal cultivation systems
    Loiseau et al.2015|European interlaboratory comparison of detection methods for" flavescence dorée" phytoplasma: preliminary results
    Torresi et al.2015|Comparison of multiple-locus variable number tandem repeat analysis and pulsed field gel electrophoresis in molecular subtyping of Listeria monocytogenes isolates from Italian cheese
    WO2012151599A2|2012-11-15|Lamp method for detecting erwinia amylovora
    Abdulrazaq et al.2016|Genetic relationship and similarity of some chicken strains
    Matovic et al.2015|The investigation of the presence of Clostridium botulinum spores in honey in Serbia
    同族专利:
    公开号 | 公开日
    AT510418B1|2012-04-15|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    WO2008089286A1|2007-01-17|2008-07-24|Meridian Bioscience Inc.|Stable reagents and kits useful in loop-mediated isothermal amplification |
    WO2009049630A1|2007-10-16|2009-04-23|Aarhus Universitet|Isothermal amplification method for detection of nucleic acid mutation|
    WO2009063243A2|2007-11-14|2009-05-22|Belfast Health And Social Care Trust|Detection of neisseria meningitidis by loop mediated by loop mediated isothermal amplification assay|WO2012151599A3|2011-05-06|2013-01-10|Technische Universität Wien|Lamp method for detecting erwinia amylovora|
    CN103114137A|2013-01-25|2013-05-22|郑媛|Fluorescent PCRquick detection primer and kit for pear fire blight pathogenic bacteria|
    法律状态:
    2018-01-15| MM01| Lapse because of not paying annual fees|Effective date: 20170506 |
    优先权:
    申请号 | 申请日 | 专利标题
    AT6402011A|AT510418B1|2011-05-06|2011-05-06|LAMP PROCEDURE FOR IDENTIFYING ERWINIA AMYLOVORA|AT6402011A| AT510418B1|2011-05-06|2011-05-06|LAMP PROCEDURE FOR IDENTIFYING ERWINIA AMYLOVORA|
    PCT/AT2012/050060| WO2012151599A2|2011-05-06|2012-05-04|Lamp method for detecting erwinia amylovora|
    [返回顶部]